Flpo antibody
WebNov 21, 2016 · The dual expression vector was used for the fluorescence lifetime imaging (FLIM) screen, the ratiometric screen (RFP brightness and green component), the photostability assay using widefield... WebGrowth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) DH5alpha Copy number High Copy Gene/Insert Gene/Insert name FlpO-2A-Cre Species S. cerevisiae …
Flpo antibody
Did you know?
WebFlp recombinase is used as a tool for the generation of transgenic animals. Limitations This product is for research use only and is not approved for use in humans or in clinical … WebThe FLP-FRT system is similar to the C re-lox system and is becoming more frequently used in mouse-based research. It involves using flippase (FLP) recombinase, derived from the …
WebThe presence of TPO antibodies in your blood suggests that the cause of thyroid disease is an autoimmune disorder, such as Hashimoto's disease or Graves' disease. In … WebFlorida Surgeon General Dr. Joseph Ladapo claims the Biden administration is limiting monoclonal antibody treatments against COVID-19. According to Ladapo, the reduction …
Webflp recombinase Alt name EFS promoter driving FlpO recombinase Insert Size (bp) 212 Entrez Gene flp Promoter EF1a/EFS promoter inserted Cloning Information Cloning method Restriction Enzyme 5′ cloning site SnaI (destroyed during cloning) 3′ cloning site XbaI (not destroyed) 5′ sequencing primer ccagtacatgaccttatggg WebFlp recombinase originates from Saccharomyces cerevisiae and recognizes FRT sites in the genome. It catalyzes recombination between two FRT sites, thereby excising the …
WebBackbone manufacturer Allen Institute Vector type AAV Growth in Bacteria Bacterial Resistance (s) Ampicillin, 100 μg/mL Growth Temperature 37°C Growth Strain (s) NEB Stable Copy number High Copy Gene/Insert Gene/Insert name FlpO Species Synthetic Insert Size (bp) 1296 Promoter Beta Globin minimal promoter Cloning Information
WebFlp (Flp recombinase) Polyclonal Antibody validated in WB and ELISA. Batch-specific data available on the website. Polyclonal antibody raised in rabbit against Flp recombinase … flip my appliances fayetteville ncWebSynapsin-driven, Cre-dependent and Flp-dependent channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals. Delivery Volume 100 µL Titer ≥ 7×10¹² vg/mL Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid. Storage Store at -80℃. flip my appliances spring lake ncWebFlp-mediated excision of the transcriptional “Stop” leading to TGFβCA expression is represented. Primers used for DNA genotyping (panel c), RT-PCR (panel d, e and Fig. 5b–d) are represented by grey... We would like to show you a description here but the site won’t allow us. flip my cameraWebSynapsin driven, Cre and Flp-dependent EYFP expression. These AAV preparations are suitable purity for injection into animals. Delivery Volume 100 µL Titer ≥ 1×10¹³ vg/mL Pricing $350 USD for preparation of 100 µL … greatest guns of all timeWebFeb 21, 2024 · a Schematic of the intersectional, anterograde transsynaptic targeting of neurons that receive monosynaptic inputs from two upstream brain regions. b EYFP fluorescence in 293T cells transfected... greatest hair metal bands of all timegreatest halftime show of all timeWeb1. Centrifuge at 5,000×g for 5 min. 2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g. 5.Store the plasmid at -20 ℃. flip my camera on computer